Production of the guide RNA from the self-processing ribozyme-gRNA-ribozyme (RGR) transcripts
Once the ribozyme-gRNA-ribozyme (RGR) cassette is made by either overlapping PCR or direct gene synthesis, the whole RGR cassette can be placed after different promoters to achieve spatial and temporal control of guide RNA expression in vivo. For in vitro assays, T7, T3 or SP6 promoters could be attached to the cassette, and the mixture from the in vitro transcription reaction could be directly used for efficient CAS9-mediated DNA cleavage.
An example of RGR cassette design from our recent publication (DOI: 10.1111/jipb.12152).
The sequence of the RGR cassette in this design (5' to 3'):
>HH-gRNA-HDV
NNNNNNCUGAUGAGUCCGUGAGGACGAAACGAGUAAGCUCGUC
NNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU
AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU
GGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCCG
GCUGGGCAACAUGCUUCGGCAUGGCGAAUGGGAC